Menu schließen

Genetics/Genetik Grundlagen

Alles zu Ausarbeitungen, Interpretationen und Zusammenfassungen

What is genetics?



The study of inherited characteristics and the way it is passed on from one generation to another is called genetics. Genetics include the scientific study of heredity and hereditary variation.
Heredity

The reason children look similar to their parents is that we inherit traits. The passing of traits from parents to child is the basis of heredity.
Our genes encode the instructions that define our traits. Each of us has thousands of genes, which are made of DNA and reside in our chromosomes. The environment we grow up and live in also helps define our traits.

Humans have two complete sets of 23 chromosomes. When parents conceive a child, they each contribute one set to the child. In this way, parents pass genes to the child.
Every child receives half of the chromosomes from the mother and half from the father. This transfer takes place at conception, when the father's sperm cell joins with the mother's egg cell. While most cells in our bodies contain two sets of chromosomes, sperm and egg cell each have only one set. When they join, they create a single cell, called zygote, which has two sets of chromosomes. This cell will divide, ultimately develop into a child.

Each parent contributes one complete set of chromosomes to the child. This can contain chromosomes from both of the parent's two sets. The only rule is that the child must receive exactly one of each chromosome.

Since the parents contribute chromosomes randomly to each new child, every child inherits a unique set of chromosomes. As a result, every child will have a unique combination of traits. Some will resemble the mother; and some will resemble the father. Still other will be unique, a product of the combination of chromosomes.

If one of the children grows up and has a family, she or he will contribute a mixture of her own chromosomes to each new child. This is how some traits are passed though many generations.

A trait is a notable feature or quality in a person. Each of us has a different combination of traits that makes us unique. Traits are passed from generation to generation. We inherit traits from our parents, and we pass them to our children.

Physical traits are characteristics of one's physical makeup. They include eye color, hair color or height.
Behavioral traits are characteristics of the way one acts. A sheepdog's herding instinct or a retriever's desire to fetch is a good example of behavioral traits.

Predisposition to a medical condition: An increased risk of getting a certain type of disease is also a type of trait that can be passed from parent to child. Some examples of such disease include sickle cell anemia, cystic fibrosis, heart disease, cancer or certain types of mental illness.
The instructions encoded in our genes play a role in defining traits. But the non-genetic, or environmental, influences in our lives are just as important in shaping our traits. Sometimes these environmental factors can even change a trait.

Physical traits: Our genes determine our natural hair color but the exposure to sun or hair dyes can easily change that color.

Behavioral traits: People breed retrievers to chase things and bring them back, but of course one can train a retriever to instead roll over and play dead when one tosses a ball.
Predisposition to a medical condition: A person may be born with an increased risk of heart disease, but eating healthy foods and exercising can reduce this risk.

Scientists describe the set of genetic information as an allele. They determine which trait is shown. Scientists use the word homozygous to describe having two of the same allele for a trait. When two different alleles are present, they interact. To describe having two different alleles for a trait the word heterozygous is used. In this case one allele is dominant and one is recessive. The dominant allele is shown.

Mother and father each have two alleles for a certain quality. When they have a child, they pass one of their two alleles to the child. The child's trait is determined by the alleles she receives from her parents. Each child can receive a different combination of alleles. But alleles can also work together to produce incomplete dominance. For example crossing a red carnation plant with a white one can produce pink carnations.

Traits influenced by just one gene are rare. These are called single genes. Most of the time, traits are shaped by more than one gene - and sometimes many. These are called complex genes.

Underneath the surface, people are remarkably alike. All humans share 99, 9 percent identical DNA. It's those very few differences in our DNA that create the diversity one sees.

Chromosomes and karyotypes

Each cell in our body contains a lot of DNA. In fact, if you pulled the DNA from a single human being cell and stretched it out, it could be a few meters long. It fits into the cell because it is packaged into compact units called chromosomes.

The packaging of DNA into a chromosome is done in several steps, starting with the double helix of DNA. Then the DNA is wrapped around some proteins. These proteins are packed tightly together until they form a chromosome. Chromosomes are efficient storage units for DNA.

Each human cell has 46 chromosomes. The entire DNA is organized into two sets of 23 chromosomes. We get genetic material from both of our parents - that's why children look like both their mom and dad.
In a karyotype there is a set of chromosomes. Matching chromosomes are lined up in pairs - one each from mom and dad. There are two sex chromosomes that determine whether one is male or female. A male has an X and a Y chromosome, a female has two X chromosomes.
Not all living things have 46 chromosomes. Mosquitos, for instance, have 6. Onions have 16. Carp have 104.

DNA

Instructions providing all of the information necessary for a living organism to grow and live reside in the nucleus of every cell. These instructions tell the cell what role it will play in the body.

The instructions come in the form of a molecule called DNA. DNA encodes a detailed set of plans for building different parts of the cell. DNA stands for Deoxyribonucleic Acid.
The DNA molecule comes in the form of a twisted ladder shape called double helix. The ladder's rungs are built with A, C, T and G, A always pairs with T and C always pairs with G. they are all bases, that are hold together in the middle by a hydrogen bond. The rest is a sugar phosphate backbone.
The DNA letters stand for Guanine, Adenine, Thymine and Cytosine.

The DNA strand is made of these letters:
ATGCTCGAATAAATGTCAATTTGA

The letters make words that form sentences:
<ATG CTC GAA TAA> <ATG TCA ATT TGA>

These sentences are called genes. Genes tell the cell to make other molecules called proteins. They enable the cell to perform special functions, such as working with other groups of cells to make hearing ore tasting possible.

Genes

Genes are instruction manuals for our bodies. They are the directions for building all the proteins that make our bodies function. Genes are made of DNA. One strand of DNA contains many genes. All of these genes are needed to give instructions for how to make and operate all parts of our bodies.

For example, blood contains red blood cells that transport oxygen. The cells use a protein called hemoglobin to capture and carry the oxygen.

Of our 25.000 genes, only a few contain the instructions for making hemoglobin proteins. The remaining genes contain the instructions for making other parts of our body. If our hemoglobin gene is normal, the hemoglobin gene works fine. But if instructions in that gene are changed, or mutated, changes in the hemoglobin protein could result. One such mutation causes a disorder called sickle cell anemia.
Genes contain instructions for building proteins, which are involved in all sorts of things. Hemoglobin protein is just one example. Other proteins such as the enzymes that produce pigment in our eyes and keratin, responsible for growing hair and nails, are also produced by genes.

Proteins

Our body is made up of about 100 trillion cells. Each of these cells is responsible for a specific job. Every cell contains lots of different proteins, which work together like tiny machines to run the cell.

Nerve networks are responsible for the sensation of pain. They send the pain signal from the hurt part of the body to the brain almost instantly. Our nerve networks are made up of individual cells arranged end-to-end, like a telephone line, to transmit the pain signal. The receiving end of each cell in the line contains special proteins on its surface, called receptor proteins. Receptor proteins are responsible for picking up the signal and passing it along to the next cell.

These nerve cells aren't round. Instead they've got grown branches, which help them communicate with their neighbors in the line. Special proteins called structural proteins help cells extend these branches and hold them in place. Structural proteins are like bricks, stacking together to form column-like supports that give the cell its shape. These proteins are just two of thousands that help the nerve cell do its job. Every cell in the body is just as complex.
Cells use the information encoded in their genes, which are a sort of protein library, as the blueprint for making proteins. Each gene in the DNA encodes information about how to make an individual protein.

When a cell needs to make a certain protein, specialized machinery within the cell's nucleus reads the gene and then uses that information to produce a molecular message in the form of RNA, a molecule very similar to DNA. RNA (Ribonucleic Acid) moves from the nucleus into the cytoplasm of the cell. Once there, the cell's protein making machinery, the ribosome, reads the message and produces a protein that exactly matches the specifications laid out in the gene.

Once made, the protein travels to the part of the cell where it is needed and begins to work. Each step in making a protein itself requires the work of highly specialized proteins.

Mitosis and cell cycle

Cell division is an elegant process that enables organisms to grow, repair and reproduce. Through a sequence of steps, the replicated genetic material in a parent cell is equally distributed to two daughter cells. While there are some differences, mitosis is remarkably similar across organisms.
Before a dividing cell enters mitosis, it undergoes a period of growth called interphase. Interphase is the "holding" stage or the stage between two successive cell divisions. In this stage, the cell replicates its genetic material and organelles in preparation for division. There can be no chromosomes seen in the nucleus, because they are so long and thin that they are invisible.

Mitosis is composed of several stages:

Prophase: In prophase, the chromatin condenses into discrete chromosomes. It seems the chromosomes are getting short and fat, so they can be seen with a light microscope. Each chromosome produces a replica of itself. The original chromosome and the replica are called chromatids. They are held together by a point called centromere.

Metaphase: The nuclear membrane vanishes and the chromosomes line up in the middle of the cell which is called the equator. They become attached to spindles that form at opposite "poles" of the cell. In metaphase, the chromosomes are aligned at the metaphase plate (a plane that is equally distant from the two spindle poles).

Anaphase: In anaphase, the paired chromosomes (sister chromatids) move to opposite ends of the cell. First the centromere of each chromosome splits and the spindle fibres shorten so that the two chromatids in each chromosome separate. The chromatids move away from each other along the spindle fibre to opposite ends of the cell. The cell starts to split into two.

Telophase: The chromatids arrive at opposite ends of the cell and thus become the chromosomes of the new daughter cells. A nuclear membrane appears around each group. The spindle fibres fade away.

Late Telophase: The chromosomes become long and thin again, so that they are invisible. Cytokinesis takes place. The cytoplasm divides, forming two daughter cells and we now have two daughter cells each containing the same number of chromosomes as the parent cell. Each cell now goes into Interphase again.

At the end of mitosis, two distinct cells with identical genetic material are produced.

Meiosis

The egg cell and the sperm cell each need to have a haploid chromosome number, otherwise the number of chromosomes would double in every new generation. So the number of chromosomes must be reduced. This is the result of meiosis.
As with mitosis there are different stages of meiosis. Interphase, where the genetic material, the chromosomes, is replicated, takes place before.

Prophase I: The chromosomes become visible under a light microscope and get in their normal form.

Metaphase I: The nuclear membrane vanishes. The homologous chromosomes arrange at the equator, one chromosome always in the direction of one spindle fibre.

Anaphase I: The homologous pairs of chromosomes are pulled to the ends of the cell by the spindle fibres. There's a random distribution of male and female Chromosome pairs.

Telophase I: in this phase the cells separate. There are now two cells with different genetic material. The chromosomes become invisible.

Prophase II: The chromosomes again become visible and spindle fibres appear. The chromosomes shorten and the nuclear membrane vanishes.

Metaphase II: The daughter cells begin to build new spindle fibre and the chromosomes arrange at the equator.
Anaphase II: The sister chromatids separate and a separation of the chromosomes in to chromatids takes place. Thus move then to the ends of the cell.

Telophase II: The two daughter cells of meiosis become each two new cells, so that there are collectively four cells that all have a haploid chromosome number. In this phase also a new nuclear membrane is formed.
Inhalt
Englischsprachige Zusammenfassung zum Thema Genetics/Genetik.
Es werden Grundlagen beschrieben, z.B: Genes, Proteins, Heredity, DNA, aber auch im Detail Mitosis und Meiosis. Die Zusammenfassung stammt aus dem biligualen Biologie Unterricht am Gymnasium. (2348 Wörter)
Hochgeladen
von unbekannt
Optionen
Hausaufgabe herunterladen: PDFPDF, Download als DOCXDOCX
  • Bewertung 3.9 von 5 auf Basis von 31 Stimmen
  • 1
  • 2
  • 3
  • 4
  • 5
3.9/5 Punkte (31 Votes)



Seite drucken | Melden
Kostenlos eine Frage an unsere Englisch-Experten stellen:

0 weitere Dokumente zum Thema "Ausarbeitungen, Interpretationen und Zusammenfassungen"
42 Diskussionen zum Thema im Forum
Wenn du dieses Dokument verwendest, zitiere es bitte als: "Genetics/Genetik Grundlagen", https://e-hausaufgaben.de/Hausaufgaben/D10795-GeneticsGenetik-Grundlagen.php, Abgerufen 18.07.2026 16:42 Uhr

Es handelt sich hier um einen fremden, nutzergenerierten Inhalt für den keine Haftung übernommen wird.
Download: PDFPDF, Download als DOCXDOCX
PASSENDE FRAGEN:
  • Kann jemand meinen Text korriegieren ?
    It seems as if Researchers Forget that genetic plant can no longer be controlled if they are once in nature, as in the ..
  • Genetik
    Hi Leute... Ich schreib morgen ne Englisch Arbeit über Genetik und brauche dringen mal nen Paar Tipps von euch... Es geht um ..
  • Is genetic key to climate change
    Hallo, ich muss ein Vortrag in Englisch halten. Und zwar geht es um die Klima Veränderung, ob wir oder vor allem wie wir den ..
  • Alone
    Hat jemand eine oder drei Zusammenfassungen von dem Buch Alone von Jane Rollason
  • deutsche zusammenfassung
    ich brauche die deutschen zusammenfassungen von: the legend of sleepy hollow and saturday night sunday morning!
  • mehr ...