Menu schließen

Mutationsmöglichkeiten - Bestimmungsschlüssel

Frage: Mutationsmöglichkeiten - Bestimmungsschlüssel
(2 Antworten)


Autor
Beiträge 6
0
Hallo! Ich habe Hausaufgaben in Biologie und komme leider nicht weiter, weil ich das Thema nicht verstehe.


Aufgabe:
Der folgende, codogene Strang soll transkribiert und translatiert werden:
3‘ATGAGCCGTACGTAGCTAGGGTTTACCGTTGA5‘
Stelle im vorgegebenen Strang an einer beliebigen Stelle die versch. Genmutationen (Modifikaton,Genommutation,Mutation,Genmutation,Punktmutation,Deletion,Insertion) dar und mache sie durch Markierung deutlich.

Bitte um Hilfe! :(
Frage von Lara.suchthilfe | am 09.11.2020 - 17:42


Autor
Beiträge 37748
1842
Antwort von matata | 09.11.2020 - 18:08
Hast
du nicht ein Bild von diesem Strang? So kann man das wirklich fast nicht entziffern.
________________________
 e-Hausaufgaben.de - Team


Autor
Beiträge 37748
1842
Antwort von matata | 10.11.2020 - 04:32
Vielleicht hilft dir das...

https://asset.klett.de/assets/999028b5/A01515_04556101.pdf
---> siehe Lösungen Seite 12

https://www2.klett.de/sixcms/media.php/229/Codesonne.pdf
---> siehe Codesonne

https://www.youtube.com/watch?v=U38J7Qg_ba0

https://www.youtube.com/watch?v=i9AoX0g_5Pw

https://www.youtube.com/watch?v=oaEeQ1vGgA0

https://www.youtube.com/watch?v=2d-IBZAduo8
---> Arbeit mit der Codesonne / Beispiele

https://www.dcode.fr/codons-genetic-code ---> Übersetzer für DNA-Stränge

In deinem Strang hat es vermutlich einen Schreibfehler, es müssten ja 33 Zeichen sein. Zur besseren Lesbarkeit ordnet man sie in 3-er-Gruppen.
________________________
 e-Hausaufgaben.de - Team

Verstoß melden Antworten
Hast Du eine eigene Frage an unsere Biologie-Experten?

> Du befindest dich hier: Support-Forum - Biologie